HIGHLIGHTS
- The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples.
- 100% automation ready with only a single PCR step and without the need for normalization.
- Real-time PCR enables absolute microbial copy number quantification.
DESCRIPTION
The Quick-ITS Plus NGS Library Prep Kit is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing.
The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure® bead-based clean-ups.
Additional library quantification analysis such as TapeStation® analysis or gel electrophoresis are not necessary.
With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes.
TECHNICAL SPECIFICATIONS
| Amplicon Size |
The final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp. |
| Barcode Sequences |
10 bp barcodes |
| Index Primers |
Dual index (barcodes) to uniquely label samples. |
| ITS Primer Sequences |
(adapters not included)
ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp). |
| Required Equipment |
Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates. |
| Sample Input |
Purified microbial DNA ≤100 ng, free of PCR inhibitors. |
| Sequencing Platform |
Illumina MiSeq® without the need to add custom sequencing primers. Zymo Research recommends the MiSeq® Reagent Kit v3 (600-cycle). For assistance with sample sheet setup, see Appendix F. |
FORMAT
| Cat # |
Name |
Size |
| D6424-PS1 |
Quick-ITS Plus NGS Library Prep Kit with Primer Set 1 |
96 rxns |
| D6426 |
Quick-ITS Plus NGS Library Prep Kit |
24 rxns |
| D6424-PS2 |
Quick-ITS Plus NGS Library Prep Kit with Primer Set 2 |
96 rxns |
| D6424-PS3 |
Quick-ITS Plus NGS Library Prep Kit with Primer Set 3 |
96 rxns |
| D6424-PS4 |
Quick-ITS Plus NGS Library Prep Kit with Primer Set 4 |
96 rxns |